ISSN 2085-5842
Vol. 6 / No. 2 / Published : 2014-11
Order : 2, and page :117 - 123
Related with : Scholar Yahoo! Bing
Original Article :
Genetic diversity cythochrome b of sidat (anguila bicolor) assesed by restriction fragment length polymorhisme (rflp)
Author :
- Lestari Wilujeng*1
- Gunanti Mahasri*2
- Mufasirin*3
- Mahasiswa Fakultas Perairan dan Kelautan
- Dosen Fakultas Perairan dan Kelautan
- Dosen Fakultas Kedokteran Hewan
Abstract :
This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 ') . PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %.
Keyword :
Cytochrome b, , Anguila bicolor, RFLP-mtDNA,
References :
T. A. Brown,(1991) Pengantar Kloning Gen Yogyakarta : Yayasan Essentia Medica
Duryadi,(1994) Peran DNA Mitokondria (mt DNA) dalam studi keragaman genetic dan biologi populasi pada hewan Bogor : Jurnal Biologi FMIPA IPB
M.I. Effendi,(1997) Biologi Perikanan Yogyakarta : Yayasan Pustaka Nusatama
Archive Article
Cover Media |
Content |
Volume : 6 / No. : 2 / Pub. : 2014-11 |
- Identification Of Koi Herpes Virus At Different Dose With Streptavidin Biotin Methods Immunohistochemistry On Tilapia (oreochromis Niloticus)
- Genetic Diversity Cythochrome B Of Sidat (anguila Bicolor) Assesed By Restriction Fragment Length Polymorhisme (rflp)
- Vertebrae Malformation Tilapia Fish (oreochromis Niloticus) On Different Media Hatching Saline
- The Isolation Development Of Chondroitin Sulphate From Cuttlebone (sepia Phraonis), Ray’s Cartilage (raja Sp.), And Shark (carcharinus Falciformes)
- Applications Of Addition Earthworms (lumbricus Rubellus) On Feed Of Sangkuriang Catfish (clarias Sp.)
- Monitoring Of Water Quality On Rearing Ponds Of Vannamei Shrimp (litopenaeus Vannamei) In Situbondo, Jawa Timur
- The Total Of Cellulolytic Bacteria In Gunung Anyar Surabaya And Bancaran Bangkalan Estuaries
- Water Quality Standards For Marine Life And Pollution Index In Cirebon Coastal Area In The Dry Season
- Effect Of Mung Bean Sprouts Essences Against Malondialdehyde Levels In African Catfish (clarias Gariepinus) That Was Infected By Bacteria Aeromonas Hydrophila
- Predilection And Anatomical Pathology Changes In Goldfish (carassius Auratus) Due To Lernaea Cyprinacea Infestation In Tulungagung
- Effect Of Rhizome Extract (kaempferia Galanga L.) For The Cure Rate Of Catfish Fry (clarias Sp) Infected By Saprolegnia Sp
- Antifungal Activity Test Of Basil Leaves Juice (ocimum Sanctum Linn.) Against Aspergilllus Terreus By In Vitro
- Effect Of Different Substrates On The Recirculation System For Local Sea Cucumber (phyllophorus Sp.) Physiological During Adaptation Period
- Exploration Of Brown Seaweed (phaeophyceae) Active Subtance As Aedes Aegypti Biolarvicides
- The Bioabsorbtion Effects Of Mangrove Avicennia Alba Against Ammonia (nh3)
- Analysis Of Heavy Metal Concentration Difference Value On Cadmium (cd) Against Seaweed (eucheuma Cottonii) In Pamekasan And Sumenep Seashore - Madura
- Study Of Heavy Metal Content Of Mercury (hg) And Prediction Content Of Methyl Mercury (ch3hg) On The Blood Shellfish’ (anadara Granosa) Organs In Sidayu And Banyu Urip District, Gresik, East Java
- The Effects Of Bandotan Leave’s (ageratum Conyzoides) Essential Oil Within Closed System Transportation Of Koi Carp (cyprinus Carpio).
|